View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9299_high_11 (Length: 201)
Name: NF9299_high_11
Description: NF9299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9299_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 25204776 - 25204912
Alignment:
| Q |
19 |
ggttaaaaaatgaagataaatttatgaggaggaatgagaggaagaccttggaagctgtagccatggttttcaatttcaacaatgagagacnnnnnnnntt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
25204776 |
ggttaaaaaatgaagataaatttatgaggaggaatgagaggaagaccttggaagctgcagccatggttttcaatttcaacaatgagagac-aaaaaaatt |
25204874 |
T |
|
| Q |
119 |
aatgaaacaatttatgttaaaacaaaaggaaaaattgg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25204875 |
aatgaaacaatttatgttaaaacaaaaggaaaaattgg |
25204912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University