View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9299_high_8 (Length: 304)
Name: NF9299_high_8
Description: NF9299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9299_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 157 - 298
Target Start/End: Complemental strand, 5198193 - 5198052
Alignment:
| Q |
157 |
ttggtagaatctgactaaattgagttgtgatttttaggaccattagattgtctcatttgctcaacaacgtgaggtgatatagatctttgcgtgaacggtg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5198193 |
ttggtagaatctgactaaattgagttgtgatttttaggaccattagattgtctcatttgctcaacaacgtgaggtgatatagatctttgcgtgaacggtg |
5198094 |
T |
|
| Q |
257 |
aaacatgttgtggtgggtgttgatgaaccagaaaggacgtga |
298 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5198093 |
aaacatgttgtggtggctgttgatgaaccagaaaggacgtga |
5198052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 5198281 - 5198196
Alignment:
| Q |
14 |
aaaggaagttcatcctcattcattctctttgatgaaccattggatttgcttatttgcagttctttattatcttccaatgatcgata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5198281 |
aaaggaagttcatcctcattcattctctttgatgaaccattggatttgcttatttgcagttctttattatcttccaatgatcgata |
5198196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 13 - 162
Target Start/End: Complemental strand, 5058986 - 5058837
Alignment:
| Q |
13 |
caaaggaagttcatcctcattcattctctttgatgaaccattggatttgcttatttgcagttctttattatcttccaatgatcgataaggtgaaaaattt |
112 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| || ||| | | | |||||||| |||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
5058986 |
caaaggaagttcatctcttttcattctcttggatggactattagctatacttatttgtagttctttattatcttccaatgattggtaaggtgaaaaattt |
5058887 |
T |
|
| Q |
113 |
cttgagattacttggcttatccgagtggaaatgttagatgaattttggta |
162 |
Q |
| |
|
|||| ||||| || |||||| ||||||| |||||||||| | ||||||| |
|
|
| T |
5058886 |
cttgccattacatgacttatctgagtggacatgttagatggactttggta |
5058837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 5178372 - 5178414
Alignment:
| Q |
179 |
agttgtgatttttaggaccattagattgtctcatttgctcaac |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5178372 |
agttgtgatttttaggacaattagattgtttcatttgctcaac |
5178414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 1795597 - 1795549
Alignment:
| Q |
52 |
attggatttgcttatttgcagttctttattatcttccaatgatcgataa |
100 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1795597 |
attggctttacttatttgtagttctttattatcttccaatgattgataa |
1795549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 100
Target Start/End: Original strand, 5185409 - 5185457
Alignment:
| Q |
52 |
attggatttgcttatttgcagttctttattatcttccaatgatcgataa |
100 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
5185409 |
attggctttacttatttgtagttctttattatcttccaatgattgataa |
5185457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 100
Target Start/End: Original strand, 6231922 - 6231970
Alignment:
| Q |
52 |
attggatttgcttatttgcagttctttattatcttccaatgatcgataa |
100 |
Q |
| |
|
||||| ||| |||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
6231922 |
attggctttacttatttgtagttatttattatcttccaatgattgataa |
6231970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University