View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9299_low_28 (Length: 280)
Name: NF9299_low_28
Description: NF9299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9299_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 37864968 - 37864703
Alignment:
| Q |
7 |
gatacgacatgtcttctctgagaaacgccgttcccagacctgctcacaaagagcgtcctcaaccgtaactctctttcctttcctcttcacataaaccatc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37864968 |
gatacgacatgtcttctctgagaaacgccgttcccagacctgctcacaaagagcgtcctcaaccgtaactctctttcctttcctcttcacaaaaaccatc |
37864869 |
T |
|
| Q |
107 |
actgtatttt-cttcaattttatttgannnnnnncttcattattaggtcttcgaggaagaaattcgggatacttgaaaagcataaagactatgtcgaacg |
205 |
Q |
| |
|
||| |||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37864868 |
actatatttttcttcaattttattcgatttttttcttcattattaggtcttcgaggaagaaattcgggatacttgaaaagcataaagactatgtcgaacg |
37864769 |
T |
|
| Q |
206 |
tgctaaagcctttcatgtgaaagaagacactttacgggtgcatcaactatttcaccctttctctgc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37864768 |
tgctaaagcctttcatgtgaaagaagacactttacgggtgcatcaactatttcaccctttctctgc |
37864703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University