View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9299_low_32 (Length: 270)
Name: NF9299_low_32
Description: NF9299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9299_low_32 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 51 - 270
Target Start/End: Original strand, 14879905 - 14880124
Alignment:
| Q |
51 |
ccaagaatacaatatttgatttgatttctctagaatgtgtaagtggtttactaaaatagttttcttaaatttgactgannnnnnnagacatacataccaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14879905 |
ccaagaatacaatatttgatttgatttctctagaatgtgtaagtggtttactaaaatagttttcttaaatttgactgatttttttagacatacataccaa |
14880004 |
T |
|
| Q |
151 |
ttaagcatacacataaattttccaatgcatgtaaaaggtttttgcttggaactatatgaatagatatactaatcaacaatatgaatattaggtgaaaaca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14880005 |
ttaagcatacacataaattttacaatggatgtaaaaggtttttgcttggaactatatgaatagatatactaatcaacaatatgaatattaggtgaaaaca |
14880104 |
T |
|
| Q |
251 |
gaatggaaaatatgcaatat |
270 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14880105 |
gaatggaaaatatgcaatat |
14880124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 14880387 - 14880342
Alignment:
| Q |
12 |
catcatcaaggcaagtatgtgatcttcttctacatgtatccaagaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14880387 |
catcatcaaggcaagtatgtgatcttcttctacatgtatcctagaa |
14880342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University