View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9299_low_33 (Length: 254)
Name: NF9299_low_33
Description: NF9299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9299_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 18292534 - 18292768
Alignment:
| Q |
1 |
atgaaatgcaagaatcttcaaaaataagagtgataatatccaccacttgcttgaaaacatatgcgcaatcttttgactggttgaatggaaaaaattactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18292534 |
atgaaatgcaagaatcttcaaaaataagagtgataatatccaccacttgcttgaaaacatatgcgcaatcttttgactggttgaatggaaaaaattactt |
18292633 |
T |
|
| Q |
101 |
ccttgcttttgactatcatatggcgactaaatccttttaactccttgtaatagttgtctttattttctctttgttgtaccattatttttctgtttgcttc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18292634 |
ccttgcttttgactatcatatggtgactaaatccttttaactccttgtaatagttgtctttattttctctttgctgtaccattatttttctgtttgct-- |
18292731 |
T |
|
| Q |
201 |
tctctagcacttcttctgcagagtaagtaaagaatgttg |
239 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18292732 |
--tctagcgcttcttctgcagagtaagtaaagaatgttg |
18292768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 85
Target Start/End: Complemental strand, 40155427 - 40155346
Alignment:
| Q |
6 |
atgcaagaatcttcaaaaataagagtgataatatccaccacttgcttgaaaacat--atgcgcaatcttttgactggttgaa |
85 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||||||||||||||||| || ||||| | |||||||||||||| |||||||| |
|
|
| T |
40155427 |
atgcaagaatcttcaagaataaaaatgataatatccaccacttgctcgacaacataaaagcgcaatcttttgattggttgaa |
40155346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 33519315 - 33519368
Alignment:
| Q |
186 |
ttttctgtttgcttctctctagcacttcttctgcagagtaagtaaagaatgttg |
239 |
Q |
| |
|
|||||| |||| |||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
33519315 |
ttttctatttgtttctctctagcactccttgtgcagagtaagtaaagaatgttg |
33519368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 18747652 - 18747596
Alignment:
| Q |
31 |
tgataatatccaccacttgcttgaaaacat--atgcgcaatcttttgactggttgaa |
85 |
Q |
| |
|
|||||||||||||||||| ||||| ||| | | ||||||||||||||||||||||| |
|
|
| T |
18747652 |
tgataatatccaccactttcttgacaacgttaaggcgcaatcttttgactggttgaa |
18747596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University