View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9300_low_15 (Length: 262)
Name: NF9300_low_15
Description: NF9300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9300_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 50004545 - 50004292
Alignment:
| Q |
18 |
gtgtttatccaaacatgacctaaaccacaaagtaccaacaagta----------tcaaacagtattgattaagaaataacaacatacagtgtatattcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50004545 |
gtgtttatccaaacatgacctaaaccacaaagtaccaacaagtaccaagaagtatcaaacaatattgattaagaaataacaacatacagtgtatattcaa |
50004446 |
T |
|
| Q |
108 |
gatatccatcaactcttggtttggcaacactcccagaagctctctttcgtcttgattcaacgcgaaagttagcagggcaagttggattggaagattcccc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50004445 |
gatatccatcaactcttggtttggcaacactcccagaagctctctttcgtcttgattcaacgcgaaagttagcagggcaagttggattggaagattcttc |
50004346 |
T |
|
| Q |
208 |
ttttacaaaatcatcaactctagcaaaaggaatcaaagcaatatcatcaccacc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50004345 |
ttttacaaaatcatcaactctagcaaaaggaatcaaagcaatatcatcaccacc |
50004292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University