View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9300_low_16 (Length: 253)
Name: NF9300_low_16
Description: NF9300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9300_low_16 |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 34090487 - 34090732
Alignment:
| Q |
8 |
gagaagcagagaaagatatagtacacaacagtaaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34090487 |
gagaagcagagaaagatatagtacacaacagtaaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgca |
34090586 |
T |
 |
| Q |
108 |
tgcttgatcaggtgcacacccgttttgagtatctgtgtttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcagtaact |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34090587 |
tgtttgatcaggtgcacacccgttttgagtatctgtgtttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcaataact |
34090686 |
T |
 |
| Q |
208 |
gtggctaccaccattaaggaacctctcatttgttccatccaatttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34090687 |
gtggctaccaccattaaggaacctctcatttgttccatccaatttc |
34090732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 145 - 253
Target Start/End: Original strand, 34093569 - 34093677
Alignment:
| Q |
145 |
tttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcagtaactgtggctaccaccattaaggaacctctcatttgttcca |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34093569 |
tttgattgccaaacacctcctggtgggtttattgcaatttggaaagttaaggatgccataactgtggctaccaccattagggaacctctcatttgttcca |
34093668 |
T |
 |
| Q |
245 |
tccaatttc |
253 |
Q |
| |
|
||| ||||| |
|
|
| T |
34093669 |
tcctatttc |
34093677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 34093460 - 34093553
Alignment:
| Q |
8 |
gagaagcagagaaagatatagtacacaacagtaaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagc |
101 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| ||||||||||| ||| ||| ||| ||||||| | |||||||||||||||||||| |
|
|
| T |
34093460 |
gagaagcagagaaagatatagtacataacagtataaacatttcatatctaagcttttgagtgccatcaccagatgctaaaactgaagtaccagc |
34093553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 125
Target Start/End: Original strand, 34096790 - 34096878
Alignment:
| Q |
37 |
agtaaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgcatgcttgatcaggtgcaca |
125 |
Q |
| |
|
|||| ||| ||||||||||||| || || |||||||||||||| ||||||||| |||||| |||||||||| ||||||| ||||||| |
|
|
| T |
34096790 |
agtataaaaagttcatatctaaatttttggttgctatcaccaaatgctaaaactaaagtactagctttgcatatttgatcatgtgcaca |
34096878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 117
Target Start/End: Original strand, 34092660 - 34092710
Alignment:
| Q |
67 |
ttgctatcaccaaaggctaaaactgaagtaccagctttgcatgcttgatca |
117 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
34092660 |
ttgctatcaccaaatgctagaactaaagtaccagctttgcatatttgatca |
34092710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University