View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9300_low_27 (Length: 203)
Name: NF9300_low_27
Description: NF9300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9300_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 6145441 - 6145267
Alignment:
| Q |
11 |
ggagcagagagaatggtgtgaattagttcttaattttacattgattaaattctaaaatttcatctaatgatggctggaatactatatatgtttgcatgta |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6145441 |
ggagcagggagaatggtgtgaattagttcttaattttacattgattaaattctaaaatttcatctaatgatggctggaatactatatatgtttgcatgta |
6145342 |
T |
 |
| Q |
111 |
gtaaagttgtataatgtgtaaaattggtttttaattctgtgttagttactttgctttgaactgatttgaagaata |
185 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6145341 |
gtaaagttgtataatatgtaaatttggtttttaattgtgtgttagttactttgctttgaactgatttgaagaata |
6145267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University