View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9301_high_5 (Length: 271)

Name: NF9301_high_5
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9301_high_5
NF9301_high_5
[»] chr6 (1 HSPs)
chr6 (15-256)||(419643-419884)


Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 419884 - 419643
Alignment:
15 cagagagtgcactttgtgaggctgctagtatcggaggagcaattcggatactggttgagacaattgaagatggatcttcactaggaaaagagcatgcagt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
419884 cagagagtgcactttgtgaggctgctagtatcggaggagcaattcggatactggttgagacaattgaagatggatcttcactaggaaaagagcatgcagt 419785  T
115 tggcatacttctgcttatatgtcaaagctgcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgat 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
419784 tggcatacttctgcttatatgtcaaagctgcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgat 419685  T
215 ggaacgtggagagccaaatcgacggctagggaattgttgttg 256  Q
    ||||||||||||||||||||||||||||||||||||||||||    
419684 ggaacgtggagagccaaatcgacggctagggaattgttgttg 419643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University