View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9301_high_6 (Length: 258)
Name: NF9301_high_6
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9301_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 240
Target Start/End: Original strand, 40025769 - 40025996
Alignment:
| Q |
13 |
attctcaacttgattaacttctattgtgtcacttgattcattgggtgaagacacattaagactattatcaagagattcaaaatctgtttcagaaccatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40025769 |
attctcaacttgattaacttctattgtgtcacttgattcattgggtgaagacacattaagactattatcaagagattcaaaatctgtttcagaagcatct |
40025868 |
T |
|
| Q |
113 |
tctgtctgtttcaccaccttgcatgactcaacatgttcatcaatatcaacaacatcttcggtatcaccgataaacttggattttccatcacaatcatcat |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40025869 |
tctgtctgttccaccaccttgcatgactcaacatgttcatcaatatcaacaacatcttcggtatcaccgataaacttggcttttccatcacaatcatcat |
40025968 |
T |
|
| Q |
213 |
cagcagatacttcaacagctaccccctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40025969 |
cagcagatacttcaacagctaccccctt |
40025996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University