View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9301_low_19 (Length: 284)
Name: NF9301_low_19
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9301_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 95 - 269
Target Start/End: Original strand, 25007486 - 25007660
Alignment:
| Q |
95 |
atccttatttgcaacgtattttataattgtttcttacaacaaaactctttttaaaccttgatttaaaatagtgtaaacttgattgattgaaactataaca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25007486 |
atccttatttgcaacgtattttataattgtttcttacaacaaaactctttttaaaccttgatttaaaatagtgtaaacttgattgattgaaactataaca |
25007585 |
T |
|
| Q |
195 |
caatctctatggattcaatatttagtttttgataaaaactatcatacttaaattctctttatcaaccgtcaatgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25007586 |
caatctctatggattcaatatttagtttttgataaaaactatcatacttaaattctctttatcaaccgtcaatgt |
25007660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University