View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9301_low_22 (Length: 271)
Name: NF9301_low_22
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9301_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 419884 - 419643
Alignment:
| Q |
15 |
cagagagtgcactttgtgaggctgctagtatcggaggagcaattcggatactggttgagacaattgaagatggatcttcactaggaaaagagcatgcagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419884 |
cagagagtgcactttgtgaggctgctagtatcggaggagcaattcggatactggttgagacaattgaagatggatcttcactaggaaaagagcatgcagt |
419785 |
T |
 |
| Q |
115 |
tggcatacttctgcttatatgtcaaagctgcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419784 |
tggcatacttctgcttatatgtcaaagctgcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgat |
419685 |
T |
 |
| Q |
215 |
ggaacgtggagagccaaatcgacggctagggaattgttgttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419684 |
ggaacgtggagagccaaatcgacggctagggaattgttgttg |
419643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University