View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9301_low_30 (Length: 229)
Name: NF9301_low_30
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9301_low_30 |
 |  |
|
| [»] scaffold0638 (1 HSPs) |
 |  |  |
|
| [»] scaffold0451 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0638 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0638
Description:
Target: scaffold0638; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 5802 - 5578
Alignment:
| Q |
1 |
gacaatataatcactcactactaagatcatataccctctgagttcaggattgcaatgtgaagtgtgtactattgtgtatgaaacaacagatatctcgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5802 |
gacaatataatcactcactactaagatcatataccctctgagttcaggattgcaatgtgaagtgtgtactattgtgtatgaaacaacagatatctcgata |
5703 |
T |
 |
| Q |
101 |
aaatttgtagccaaatttctcctataattatgacgtctacgaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5702 |
aaatttgtagccaaatttctcctataattatgatgtctacgaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaa |
5603 |
T |
 |
| Q |
201 |
gctactatgttatggaaacatgtaa |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5602 |
gctactatgttatggaaacatgtaa |
5578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0451 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0451
Description:
Target: scaffold0451; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 214
Target Start/End: Original strand, 7711 - 7784
Alignment:
| Q |
141 |
gaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaagctactatgttatg |
214 |
Q |
| |
|
||||||| ||||||| |||||||| || |||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
7711 |
gaagaaataaatagacatgggaaacttagagatgaaattatgcattaattgtcactagcagctactatgttatg |
7784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 186
Target Start/End: Complemental strand, 38258906 - 38258861
Alignment:
| Q |
141 |
gaagaaagaaatagagatgggaaattttgagatgaaatgatgcatt |
186 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| | |||||||| |
|
|
| T |
38258906 |
gaagaaagaaatagatatgtgaaattttgagatgataagatgcatt |
38258861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University