View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9301_low_31 (Length: 229)

Name: NF9301_low_31
Description: NF9301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9301_low_31
NF9301_low_31
[»] scaffold0638 (1 HSPs)
scaffold0638 (1-225)||(5578-5802)
[»] scaffold0451 (1 HSPs)
scaffold0451 (141-214)||(7711-7784)
[»] chr8 (1 HSPs)
chr8 (141-186)||(38258861-38258906)


Alignment Details
Target: scaffold0638 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0638
Description:

Target: scaffold0638; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 5802 - 5578
Alignment:
1 gacaatataatcactcactactaagatcatataccctctgagttcaggattgcaatgtgaagtgtgtactattgtgtatgaaacaacagatatctcgata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5802 gacaatataatcactcactactaagatcatataccctctgagttcaggattgcaatgtgaagtgtgtactattgtgtatgaaacaacagatatctcgata 5703  T
101 aaatttgtagccaaatttctcctataattatgacgtctacgaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaa 200  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5702 aaatttgtagccaaatttctcctataattatgatgtctacgaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaa 5603  T
201 gctactatgttatggaaacatgtaa 225  Q
    |||||||||||||||||||||||||    
5602 gctactatgttatggaaacatgtaa 5578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0451 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0451
Description:

Target: scaffold0451; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 214
Target Start/End: Original strand, 7711 - 7784
Alignment:
141 gaagaaagaaatagagatgggaaattttgagatgaaatgatgcattaattgcaactagaagctactatgttatg 214  Q
    ||||||| ||||||| |||||||| || |||||||||| ||||||||||||  ||||| |||||||||||||||    
7711 gaagaaataaatagacatgggaaacttagagatgaaattatgcattaattgtcactagcagctactatgttatg 7784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 186
Target Start/End: Complemental strand, 38258906 - 38258861
Alignment:
141 gaagaaagaaatagagatgggaaattttgagatgaaatgatgcatt 186  Q
    ||||||||||||||| ||| ||||||||||||||| | ||||||||    
38258906 gaagaaagaaatagatatgtgaaattttgagatgataagatgcatt 38258861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University