View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_high_6 (Length: 267)
Name: NF9302_high_6
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 35 - 261
Target Start/End: Original strand, 49819291 - 49819530
Alignment:
| Q |
35 |
aattctaagaataggtagtatgcactatgcagtatgaatgttcttttat--gctcagaaacgcacctagttgatggctannnnnnnnn---------cct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
49819291 |
aattctaagaataggtagtatgcactatgcagtatgaatgttcttttatatgctcagaaacgcacctagttgatggctattttttttatttttttttcct |
49819390 |
T |
 |
| Q |
124 |
gtatggaggttaaatgaaactttgcatcataaaagttggatggctatatatggactgttatgaatacttgattttctactaacgtgtgattgttggaatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819391 |
gtatggaggttaaatgaaactttgcatcatagaagttggatggctatatatggactgttatgaatacttgattttctactaacgtgtgattgttggaatt |
49819490 |
T |
 |
| Q |
224 |
aatggcaaagatatatagtg--atagtgaatgacctatgc |
261 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
49819491 |
aatggcaaagatatatagtgatatagtgaatgacatatgc |
49819530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University