View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_low_11 (Length: 398)
Name: NF9302_low_11
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 19 - 388
Target Start/End: Complemental strand, 36788550 - 36788181
Alignment:
| Q |
19 |
tcaggccctatacccccttcagtcggtgacctcccttatcttgaaaatctcgaattccacaaactccccaggctcacgggcccaatccagcccactatcg |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36788550 |
tcaggcactatacccccttcagtcggtgacctcccttatcttgaaaatctcgaattccacaaactccccaggctcaagggcccaatccagcccactatcg |
36788451 |
T |
|
| Q |
119 |
ccaagctcacgaaactcaagtatcttttcattgaatacaccaatgtctcaggcccgataccacctttcttggcccagcataaaaacctccagcttcttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36788450 |
ccaagctcacgaaactcaagtatcttttcattgaatacaccaatgtctcaggcccgataccacctttcttggcccagcttaaaaacctccagcttcttca |
36788351 |
T |
|
| Q |
219 |
cctttccaccaacaacctctcaggcccgatcccaagctcactttcacagctacctaaccttgagtccttacacttagacagaaacaaactcacaggccca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788350 |
cctttccaccaacaacctctcaggcccgatcccaagctcactttcacagctacctaaccttgagtccttacacttagacagaaacaaactcacaggccca |
36788251 |
T |
|
| Q |
319 |
attccagaatcattcggttctttcaaaaagcccgggccagatatcatcttatctcacaaccagctctctg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788250 |
attccagaatcattcggttctttcaaaaagcctgggccagatatcatcttatctcacaaccagctctctg |
36788181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University