View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9302_low_31 (Length: 251)

Name: NF9302_low_31
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9302_low_31
NF9302_low_31
[»] chr2 (1 HSPs)
chr2 (14-251)||(4922447-4922684)


Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 4922447 - 4922684
Alignment:
14 tgttgaggaaacaaatggagacaaacaagaagaatgaattcgccctatttattacgaaagtatttagtactagacaatatcgtatcgaggatgtgaatgt 113  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
4922447 tgttgaggaaacaaatggaggcaaacaagaagaatgaattcgccctatttattactaaagtatttagtactagacaatatcgtgtcgaggatgtgaatgt 4922546  T
114 gaatgaacttaatgacctggcggcctttataaatgacaatctgaaggaaattgattggaggttgcaatcggcggaaattcaatctcaagaggaagctgga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4922547 gaatgaacttaatgacctggcggcctttataaatgacaatctgaaggaaattgattggaggttgcaatcggcggaaattcaatctcaagaggaagctgga 4922646  T
214 aatggagctgaagatatgaatggaatagggaatgaggg 251  Q
    ||||||||||||||||||||||||||||||||||||||    
4922647 aatggagctgaagatatgaatggaatagggaatgaggg 4922684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University