View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_low_34 (Length: 248)
Name: NF9302_low_34
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 24 - 238
Target Start/End: Original strand, 39142590 - 39142804
Alignment:
| Q |
24 |
gctccagggttttgacacgtggaccaccacatgattgccatgtcattcttactacgaggatcgttctcacaccccaactcaaacctcgtattgttatagt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39142590 |
gctccagggttttgacacgtggaccaccagatgattgccatgtcattcttactatggggatcgttctcacaccccaactcaaacctcgtattgttattgt |
39142689 |
T |
 |
| Q |
124 |
caaaaatactggtcattcccgtatctgtgtcactgtgtttgaccaatttttcttcgacaaaacttcccggaccccaattttcttggatttggagggtaaa |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142690 |
caaaaataccggtcattcccgtatctgtgtgactgtgtttgaccaaattttcttcgacaaaacttcccggaccccaattttcttggatttggagggtaaa |
39142789 |
T |
 |
| Q |
224 |
tatttctctgctcct |
238 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
39142790 |
tatttcactggtcct |
39142804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University