View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_low_37 (Length: 241)
Name: NF9302_low_37
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_low_37 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 6504319 - 6504094
Alignment:
| Q |
16 |
aaatccatcggtgtttaataggttgagaagcggtggatcgtatcccgatctccggcgaccggaggtggtggttgctgatggcggagattatcggtaccgg |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
6504319 |
aaatccatcggtgtttaatcggttgagaagcggtggatcgtatccggatctccgtcgaccggaggtggtggttgctgacggcggcgatgatcggtaccgg |
6504220 |
T |
|
| Q |
116 |
ttttatgatgatactcgtgtaaattttcgttatcggtatccgagatttcaagatgaagatgaatttcaccgggagacggttacttccggtgaaactttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6504219 |
ttttatgatgatactcgtgtaaattttcgttatcggtatccgagatttcaagatgaagatgaatttcaccgggagacggttacttccggtgaaactttcc |
6504120 |
T |
|
| Q |
216 |
ggcaaccggaggtgaaaccagtaacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6504119 |
ggcaaccggaggtgaaaccagtaacc |
6504094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 36 - 237
Target Start/End: Complemental strand, 6504038 - 6503843
Alignment:
| Q |
36 |
ggttgagaagcggtggatcgtatcccgatctccggcgaccggaggtggtggttgctgatggcggagattatcggtaccggttttatgatgatactcgtgt |
135 |
Q |
| |
|
||||||||||| | ||||||||| | |||||||||||| |||||| ||| |||| ||| | || | ||||||||||||||||||||||||| | | |
|
|
| T |
6504038 |
ggttgagaagcagaggatcgtattcggatctccggcgatcggaggcggtagttgttgacg------atgaacggtaccggttttatgatgatactcatat |
6503945 |
T |
|
| Q |
136 |
aaattttcgttatcggtatccgagatttcaagatgaagatgaatttcaccgggagacggttacttccggtgaaactttccggcaaccggaggtgaaacca |
235 |
Q |
| |
|
| || | ||||||| | | ||||| || ||||||||||||||||||||| | |||||||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
6503944 |
tcacttcccttatcggaactctagattggaaagtgaagatgaatttcaccgggaaaaggttacttccggtgaagtttcccggcgaccggaggtgaaacca |
6503845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University