View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_low_40 (Length: 240)
Name: NF9302_low_40
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 47161049 - 47160838
Alignment:
| Q |
12 |
agataatactacttatggattactttccttccattagccacatttttcttttgtgatccaagaataaaaacaacgagccatcgaaatcgatattgttact |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47161049 |
agatactactacttatggattactttccttccattagccacatttttcttttgtgatccaagaataaaaacaacgagccatcgaaatcgatattgttact |
47160950 |
T |
|
| Q |
112 |
gttgcatgtcaagaatttgctagttccaatccaaaagctagaaagaaagatagtcctctttgcactcaatgtggtatttttggatacatcaaggacaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47160949 |
gttgcatgtcaagaatttgctagttccaatccaaaagctagaaagaaagatagtcctctttgcactcaatgtggtatttttggatacatcaaggacaaat |
47160850 |
T |
|
| Q |
212 |
gcttgaagtttc |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47160849 |
gcttgaagtttc |
47160838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University