View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9302_low_42 (Length: 239)
Name: NF9302_low_42
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9302_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 4922886 - 4923114
Alignment:
| Q |
14 |
tcatatagttgtcttgcaaatttatgctctttgtgtgtgtctctttcaaagtatgtgtttgtgtctttcgaatttatg------------------ctca |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4922886 |
tcatatagttgtcttgcaaatttatgctctttgagtgtgtctctttcaaagtatgtgtttgtgtctttcgaatttatgtgtctttcaaaatttatgctca |
4922985 |
T |
|
| Q |
96 |
ttgggagtatgtgtttgtgtcnnnnnnnngttggtctctgtttgtattgtttcaatgtctttattttttgaagttatgcattgtgtccttgtacaacatt |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4922986 |
ttgggagtatgtgtttgtgtcttttttttgttggtctttgtttgtattgtttcaatgtctttatttttt-aagttatgcattgtgtccttgtgcaacatt |
4923084 |
T |
|
| Q |
196 |
gatgatcattttatcatcgatgaaattaat |
225 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
4923085 |
gatgatcattttatcatcaatgaaattaat |
4923114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University