View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9302_low_47 (Length: 204)

Name: NF9302_low_47
Description: NF9302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9302_low_47
NF9302_low_47
[»] chr1 (1 HSPs)
chr1 (16-162)||(48261518-48261662)


Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 16 - 162
Target Start/End: Complemental strand, 48261662 - 48261518
Alignment:
16 cataaaccagtgatatcttagctagcaaatggtactattgattcccttttagactaattaaaatagtcattgcatttggaattcatcgtgtacaaaaact 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
48261662 cataaaccagtgatatcttagctagcaaatggtactattgattcccttttagac-aattaaaatagtcattgcatttggaattcatcgtgtac-aaaact 48261565  T
116 agccacatagagaaatttgtacggaaatttaattgatttctctgagt 162  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||    
48261564 agccacatagagaaatttgtacggaaatttaattgatttctatgagt 48261518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University