View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_high_27 (Length: 259)
Name: NF9303_high_27
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 7974964 - 7975195
Alignment:
| Q |
18 |
gtattatgaactagtgcttcaatttgttttatattaatacatttggtataatctcttatttcttttatttgtaatattttgggtataatctcaaggtttc |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7974964 |
gtattatgaacttgtgcttcaatttgttttatattaatacatttggtataatctcgtatttcttttatttgtaatattttgggtataatctcaaggtttt |
7975063 |
T |
 |
| Q |
118 |
aacagaggtgatattaaagactcttctataaatgatagttttgtttgaagagttctcgtctttttctaaaggtttaaactcatcctgtattaaaaacttg |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
7975064 |
aagagaggtgatattaaagactcttctataaatgatagttttgtttgaaaagttctcgtctttttctaaaggtttaagctcatcctgtattaaaaatttg |
7975163 |
T |
 |
| Q |
218 |
gttagttaaaatctcaaggtacttttcctttg |
249 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
7975164 |
attagttaaaatctcaaggtgcttttcctttg |
7975195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University