View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_high_32 (Length: 243)
Name: NF9303_high_32
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_high_32 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 39995891 - 39995667
Alignment:
| Q |
19 |
aaggggcctttttattggaatcctaatttaggagtgactagttggttgtcattgccaatttatggacttgattttgggtgggggaaggaggtttatatgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39995891 |
aaggggcctttttattggaatcctaatttaggagtgactagttggttgtcattgccaatttatggacttgattttgggtggggaaaggaggtttatatgg |
39995792 |
T |
|
| Q |
119 |
ggctaggaacacatgaagaacttgatggagattcattgcttcttcctagtcccaatgatgatggttctttgttggttattatttgtctgcaagagatcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39995791 |
ggctaggaacacatgaagaacttgatggagattcattgcttcttcctagtcccaatgatgatggttctttgttggttattatttgtctacaagagatcca |
39995692 |
T |
|
| Q |
219 |
tatggatgcctttaagaagcatttt |
243 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
39995691 |
tatggatgtctttaagaagcatttt |
39995667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 53037707 - 53037925
Alignment:
| Q |
22 |
gggcctttttattggaatcctaatttaggagtgactagttggttgtcattgccaatttatggacttgattttgggtgggggaaggaggtttatatggggc |
121 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
53037707 |
gggccattttatgggaatccaaatttaggagtggttagttggttgacattgccaatttatggacttgattttggatgggggaaagaagtttatatggggc |
53037806 |
T |
|
| Q |
122 |
taggaacacatgaagaacttgatggagattcattgcttcttcctagtcccaatgatgatggttctttgttggttattatttgtctgcaagagatccatat |
221 |
Q |
| |
|
|||||||||||| | ||||||||||| ||||||||||||||| |||||||||| |||||||||||| ||||||| |||||||| | ||||| |
|
|
| T |
53037807 |
caggaacacatgattca---gatggagattctttgcttcttcctagttatgatgatgatggatctttgttggttgctatttgtttgcaagaggttcatat |
53037903 |
T |
|
| Q |
222 |
ggatgcctttaagaagcatttt |
243 |
Q |
| |
|
|||||| || |||| ||||||| |
|
|
| T |
53037904 |
ggatgcattcaagaggcatttt |
53037925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University