View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_high_37 (Length: 237)
Name: NF9303_high_37
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 25 - 229
Target Start/End: Original strand, 23587627 - 23587831
Alignment:
| Q |
25 |
taatatatattaccgtatctatgacattaagatcctcgtccatactcatgtcttcatactcatcttcaactacatgacttgaacttcgaatgttacatga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23587627 |
taatatatattaccgtatctatgacattaagatcctcgtccatactcatgtcttcatactcatcttcaactacctgacttgaacttcgaatgttacatga |
23587726 |
T |
|
| Q |
125 |
cttcctattgtgcccctttctcccacatgcaccgcaaacatacactttcctcggtgtttttaatttggtttgggaacacgatggaccagcacaacctttg |
224 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23587727 |
ctttctattgtgcccctttctcccacatgcaccgcaaacatacactttccttggtgtttttaatttggtttgggaacacgatggaccagcacaacctttg |
23587826 |
T |
|
| Q |
225 |
cttct |
229 |
Q |
| |
|
||||| |
|
|
| T |
23587827 |
cttct |
23587831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University