View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_high_38 (Length: 236)
Name: NF9303_high_38
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 2251560 - 2251736
Alignment:
| Q |
1 |
gatggatggagaaatagaatcaaacaaggggtaaccgaccacgtgattggagccaaaaaccaatgttttatgtgacttggtcttttctatttctattgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2251560 |
gatggatggagaaatagaatcaaacaaggggtaactgaccacgtgattggagccaaaaaccaatgttttatgtgacttggtcttttctatttctattgtg |
2251659 |
T |
 |
| Q |
101 |
tttcacaagcttcaaaattaggaataaaatacttttcatatataaaccaaacaaccctcaaaatgcttaaaccaaac |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2251660 |
tttcacaagcttcaaaattaggaataaaatacttttcatatataaaccaaacaaccctcaaaatgcttaaaccaaac |
2251736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University