View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_101 (Length: 247)
Name: NF9303_low_101
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_101 |
 | |
|
| [»] scaffold0229 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0229 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 16693 - 16928
Alignment:
| Q |
1 |
tgtgtaatttttgctacataatagtgcaattatagctaaagagggtctcatcactcttcgagtacaatttatatatgaactgacttggatggaggactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16693 |
tgtgtaatttttgctacataatagtgcaattatagctaaagagggtctcatcactcttcgagtacaatttatatatgaactgacttggatggaggactct |
16792 |
T |
|
| Q |
101 |
gaggttttttgtttctac---------attgataatatttggttaattttgtattggctttataggtatgcatttgtttgaaaagcttctatgcaatgtg |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16793 |
gaggttttttgtttctacattgataatattgataatatttggttaattttgtattggctttataggtatgcatttgtttgaaaagtttctatgcaatgtg |
16892 |
T |
|
| Q |
192 |
atatgaatttagttgcagattattaactcatccatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16893 |
atatgaatttagttgcagattattaactcatccatc |
16928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 1401665 - 1401430
Alignment:
| Q |
1 |
tgtgtaatttttgctacataatagtgcaattatagctaaagagggtctcatcactcttcgagtacaatttatatatgaactgacttggatggaggactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1401665 |
tgtgtaatttttgctacataatagtgcaattatagctaaagagggtctcatcactcttcgagtacaatttatatatgaactgacttggatggaggactct |
1401566 |
T |
|
| Q |
101 |
gaggttttttgtttctacattgataa---------tatttggttaattttgtattggctttataggtatgcatttgtttgaaaagcttctatgcaatgtg |
191 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1401565 |
gaggttttttgtttctacattgataatattgataatatttggttaattttgtattggctttataggtatgcatttgtttgaaaagtttctatgcaatgtg |
1401466 |
T |
|
| Q |
192 |
atatgaatttagttgcagattattaactcatccatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1401465 |
atatgaatttagttgcagattattaactcatccatc |
1401430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 211
Target Start/End: Complemental strand, 1376218 - 1376128
Alignment:
| Q |
124 |
taatatttggttaattttgtattggctttataggtatgcatttgtttgaaaag--cttctatgcaatgtgata-tgaatttagttgcagat |
211 |
Q |
| |
|
|||||||||||||| |||| |||| |||| |||| ||||| || ||||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
1376218 |
taatatttggttaaatttgaattgactttgtaggaatgcacttctttgaaaagttattctatgcaatgtgatagggattttagttgcagat |
1376128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University