View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_115 (Length: 240)
Name: NF9303_low_115
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_115 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 25 - 186
Target Start/End: Complemental strand, 556465 - 556304
Alignment:
| Q |
25 |
tttccttgcattgcaatattgttctcttcaaataatgcacgcctgcataatctctaattcacttacccaagtgaataattatagttttattcatgtcaat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
556465 |
tttccttgcattgcaatattgttctcttcaaataaagcacgcatgcacaatctctaattcacttgcccaagtgaataatgatagttttattcatgtcaat |
556366 |
T |
 |
| Q |
125 |
gtagctggatttctagtgcgggatatacacgaatttagctttgtgaatttaggttgatatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
556365 |
gtagctggatttctagtgcgggatatacacgaatttagctttgtgaatttaggttgatatgt |
556304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 553011 - 552967
Alignment:
| Q |
181 |
atatgttcgattaatcttgcatgtgttgatcaatgttgaatcttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
553011 |
atatgttcgattaatcttgcatgtgttgatcaatgttgaatcttt |
552967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University