View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_120 (Length: 238)
Name: NF9303_low_120
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_120 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 48966374 - 48966423
Alignment:
| Q |
166 |
gtgatatgttagatgaatgacctttaccaaaattttcatgctaatcaatc |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966374 |
gtgatatattagatgaatgacctttaccaaaattttcatgctaatcaatc |
48966423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 92
Target Start/End: Original strand, 48966260 - 48966317
Alignment:
| Q |
31 |
taatatagctttgacataatgaactcagttatcatcttaattattcgttgagtgattatatg |
92 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
48966260 |
taatttagctttgacataatgaactctgttatcatc----ttattcgttgagtgattatatg |
48966317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University