View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9303_low_120 (Length: 238)

Name: NF9303_low_120
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9303_low_120
NF9303_low_120
[»] chr7 (2 HSPs)
chr7 (166-215)||(48966374-48966423)
chr7 (31-92)||(48966260-48966317)


Alignment Details
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 48966374 - 48966423
Alignment:
166 gtgatatgttagatgaatgacctttaccaaaattttcatgctaatcaatc 215  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||    
48966374 gtgatatattagatgaatgacctttaccaaaattttcatgctaatcaatc 48966423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 92
Target Start/End: Original strand, 48966260 - 48966317
Alignment:
31 taatatagctttgacataatgaactcagttatcatcttaattattcgttgagtgattatatg 92  Q
    |||| ||||||||||||||||||||| |||||||||    ||||||||||||||||||||||    
48966260 taatttagctttgacataatgaactctgttatcatc----ttattcgttgagtgattatatg 48966317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University