View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_127 (Length: 229)
Name: NF9303_low_127
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_127 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 229
Target Start/End: Complemental strand, 35337135 - 35336914
Alignment:
| Q |
8 |
gtataggatcggattgattttcaattttatgcttatagaaggaaatcaaacctgtctcttctgttcttcattttgagctagttgtattgcaccatctaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35337135 |
gtataggatcggattgattttcaattttatgcttatagaaggcaatcaaacctgtctcttctgttcttcattttgagctagttgtattgcactatctaac |
35337036 |
T |
 |
| Q |
108 |
caggggcctagaagaaatccatcatggcaagccaacaacgtgtccaaatcttccaccaggtcaagaaatctttggctgagtagggtcacttcatggatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35337035 |
caggggcctagaagaaatccatcatggcaagccaacaacgtgtctaaatcttccaccaggtcaagaaatctttggctgagtagggtcacttcatggatat |
35336936 |
T |
 |
| Q |
208 |
ctcttgattggtatgcctcaat |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35336935 |
ctcttgattggtatgcctcaat |
35336914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University