View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_131 (Length: 220)
Name: NF9303_low_131
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_131 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 220
Target Start/End: Complemental strand, 48108218 - 48108040
Alignment:
| Q |
41 |
ttttaagccgaattttcaaagctcacaggcaatgcacgggcttataaatagccagttaatccctatagggttcattgtataagggacgtttttattttat |
140 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48108218 |
ttttaaaccgaattttcaaagctcacaggcaatgcacgggcttataaatagccagttaatccctatagg-ttcattgtataagggacgtttttactttat |
48108120 |
T |
|
| Q |
141 |
ataatgatgattagcgctaaaatgaaggttactgcaaaatgctgcaatttgttgttcatcaccacctctttccttttatt |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48108119 |
ataatgatgattagtgctaaaatgaaggttactgcaaaatgctgcaatttgttgttcatcaccacctctttccttttatt |
48108040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University