View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_135 (Length: 218)
Name: NF9303_low_135
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_135 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 30020007 - 30020097
Alignment:
| Q |
1 |
aaattattctttcgtatgcaatatcttgattannnnnnncaatgctatagtatatgaatattacatttctaaggagaagtatatataaaacc |
92 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30020007 |
aaattattctttcgtatgcattatcttgattatttttt-caatgctatagtatatgaatattacatttctaaggagaagtatatataaaacc |
30020097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 200
Target Start/End: Original strand, 30020177 - 30020205
Alignment:
| Q |
172 |
ggtcaaataaatcaatctaactagaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30020177 |
ggtcaaataaatcaatctaactagaacaa |
30020205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University