View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_137 (Length: 217)
Name: NF9303_low_137
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_137 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 201
Target Start/End: Original strand, 44568351 - 44568546
Alignment:
| Q |
6 |
tgggtagattattcttcatatagttagagatttattggaactagtttgatattgattaatatagttactagttagttataactagttctaggtctctttg |
105 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568351 |
tgggtagactatttttcatatagttagagatttattggaactagtttgatattgattaatatagttactagttagttataactagttctaggtctctttg |
44568450 |
T |
 |
| Q |
106 |
tagggctttaccgtgctttttagtagaatatgacatgtaggtcatagttccgagttattaatttgtgtacattaaactttcagaggcgtctacttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568451 |
tagggctttaccgtgctttttagtagaatatgaccggtaggtcatagttccgagttattaatttgtgtacattaaactttcagaggcgtctacttg |
44568546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University