View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_144 (Length: 208)
Name: NF9303_low_144
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_144 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 80 - 187
Target Start/End: Original strand, 44262951 - 44263058
Alignment:
| Q |
80 |
caaggcagaattattggagtagtggtggtcattggtgtggcttcttgtttgatcagagagtgcgacaaatcctgtcgcctccatatttgtttcaagggat |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44262951 |
caaggcagaattattggagtagtggtagtcattggtgtggcttcttgtttgatcagagagtgcgacaaatcctgtcgtctccatatttgtttcaagggat |
44263050 |
T |
|
| Q |
180 |
gaagtcgt |
187 |
Q |
| |
|
|||||||| |
|
|
| T |
44263051 |
gaagtcgt |
44263058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 67 - 105
Target Start/End: Original strand, 44259700 - 44259738
Alignment:
| Q |
67 |
aagttgtaatagtcaaggcagaattattggagtagtggt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259700 |
aagttgtaatagtcaaggcagaattattggagtagtggt |
44259738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University