View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_146 (Length: 203)
Name: NF9303_low_146
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 71 - 139
Target Start/End: Complemental strand, 25377705 - 25377637
Alignment:
| Q |
71 |
gacaaaaacaaagcatgtaaatgagaatgatggatttaatgcagactatacattggtaaaatgttttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377705 |
gacaaaaacaaagcatgtaaatgagaatgatggatttaatgcagactatacattggtaaaatgttttaa |
25377637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 25377802 - 25377736
Alignment:
| Q |
1 |
tctaaacagcatggattaatttgatcaccacttcaatttcttcaaacaactatgccaagaagtgtta |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377802 |
tctaaacagcatggattaatttgatcaccacttcaatttcttcaaacaactatgccaagaagtgtta |
25377736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University