View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_147 (Length: 202)
Name: NF9303_low_147
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_147 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 52 - 186
Target Start/End: Complemental strand, 24649934 - 24649800
Alignment:
| Q |
52 |
acaaatataaagaaattatatggccaatttattattctctttaggaatatatgatcattgttcttgccatactacacgtggggcaatctagagctgctag |
151 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||| |
|
|
| T |
24649934 |
acaaatataaagaaattttatggccaatttattattctttttaggaatatatgatcattgttcttgccacactacacgtggggcaatctatagctgttag |
24649835 |
T |
 |
| Q |
152 |
gaacacgtgtaaatattatcaaatttttggccttt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649834 |
gaacacgtgtaaatattatcaaatttttggccttt |
24649800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 21 - 161
Target Start/End: Complemental strand, 24656373 - 24656233
Alignment:
| Q |
21 |
ataattttttaaaactagtgcaattgtaccaacaaatataaagaaattatatggccaatttat-tattctctttaggaatatatgatcattgttcttgcc |
119 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||| ||| |||| | ||| ||||||||| |||| | || || | |
|
|
| T |
24656373 |
ataattttttaaaactactggaattgtaccaacaaatataaagaaatcatatggccaatatatatatt-ttttttggaatatattatcaattttaatgtc |
24656275 |
T |
 |
| Q |
120 |
atactacacgtggggcaatctagagctgctaggaacacgtgt |
161 |
Q |
| |
|
| ||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
24656274 |
acgctacacgtgggacaatctagagctgccagaaacacgtgt |
24656233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University