View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_34 (Length: 402)
Name: NF9303_low_34
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 7 - 387
Target Start/End: Complemental strand, 40801434 - 40801054
Alignment:
| Q |
7 |
ttggtgttgcagatgcatccagatgcatggggctgcccggtgttacctccacctcaacctccttgctattcctactctcaggtgagtatcataaaaatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801434 |
ttggtgttgcagatgcatccagatgcatggggctgcccggtgttacctccacctcaacctccttgctattcctactctcaggtgagtatcataaaaatga |
40801335 |
T |
|
| Q |
107 |
cgattttaactttatccttttgctattttgtgtgctaatagttaatacctgataatgtaattatgcctgcacaatttgtttttgctagttatttaaatta |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801334 |
caattttaactttatccttttgctattttgtgtgctaatagttaatacctggtaatgtaattatgcctgcacaatttgtttttgctagttatttaaatta |
40801235 |
T |
|
| Q |
207 |
tttacgggtgatgctaatcatatcnnnnnnnccatccaaccgtaggatatacctgcagtgagtaacgctaatgcaatggactacacatttagcatgatgc |
306 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801234 |
tttacgggtgatgctaatcatatctttttttccatccaaccgtaggatatacctgcagtgagtaacgctaatgcaatggactacacatttagcatgatgc |
40801135 |
T |
|
| Q |
307 |
cacatagttcctttgacgattatccggtaatgcaatacttccctttcagtttctttctacttgatcatagtagctacatgc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801134 |
tacatagttcctttgacgattatccggtaatgcaatacttccctttcagtttctttctacttgatcatagtagctacatgc |
40801054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University