View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_38 (Length: 363)
Name: NF9303_low_38
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 35377142 - 35377271
Alignment:
| Q |
6 |
gtttggagttgcacgtcttattcagtcaaccactattacaacggcaatgaagtaagtaacattttttatccttgtaaaatcggtaaagtttgatcgtttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
35377142 |
gtttggagttgcacgtcttattcagtcaaccactattacaacggcaatgaagtaagtaacattttttatccttgtaaaattggtaaagtttgatcttttt |
35377241 |
T |
|
| Q |
106 |
aaactattcaaacataacaagagtctcaag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35377242 |
aaactattcaaacataacaagagtctcaag |
35377271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 236 - 337
Target Start/End: Original strand, 35377372 - 35377473
Alignment:
| Q |
236 |
taatttaaatcagaaattgaaccactcactaagatttgagacaacacaaagatctggctttcatgccttaaactaatattattggctttacaatcatatg |
335 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35377372 |
taatttaaatcagaaattgaaccactccctaagatttgagacaacacaaagatcttgctttcatgccttaaactaatattattggctttacaatcatatg |
35377471 |
T |
|
| Q |
336 |
tt |
337 |
Q |
| |
|
|| |
|
|
| T |
35377472 |
tt |
35377473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University