View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_53 (Length: 344)
Name: NF9303_low_53
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 77 - 330
Target Start/End: Original strand, 12880426 - 12880682
Alignment:
| Q |
77 |
atgtagatgtgggatgcattaaacaagatatgtgattataat----tgatttactctatttttggttgcaagtcaactttccttgcgccannnnnnngga |
172 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12880426 |
atgtagacgtgggatccattaaacaagatatgtgattataatatattgatttactctatttttggttgcaagtcaactttccttgcgccatttttttgga |
12880525 |
T |
 |
| Q |
173 |
aaattctactagggttttagagaaacttttgcgtgcataacatctgactctgtttcaacgtgttatctttccgtttcaatgtgttcccttttccatatga |
272 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12880526 |
aa-ttctactagggttttagagaaacttttgcgtgcataacatctgactccgtttcaacgtgttatctttccgtttcaatgtgttcccttttccatatga |
12880624 |
T |
 |
| Q |
273 |
atgtgtatcacttcaatttctcttgtgnnnnnnnccttgttctacttttcatggcgtc |
330 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
12880625 |
atgtgtatcacttcaatttcttttgtgttcttttccttgttctacttttcatggcgtc |
12880682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University