View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_72 (Length: 308)
Name: NF9303_low_72
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 298
Target Start/End: Complemental strand, 33504895 - 33504614
Alignment:
| Q |
17 |
acatagaggaagagatcaataatggttcatttagtaggttatcctatgatattatgcttgcttgggagagacctacctactatgatgatgacgagcacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33504895 |
acatagaggaagagatcaataatggttcatttagtaggttatcctatgatattatgcttgcttgggagagacctacctactatgatgatgacgagcacat |
33504796 |
T |
|
| Q |
117 |
ggtaaaaatacacattctctatttggatcatataacggtttgtatgccgtggtgtggtagaggatccaaatccctaaaaaattcaattcttaactctatt |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33504795 |
ggtaaaaatacacattctctatttagatcatataacgatttgtatgtcgtggtgtggtagaggatccaaatccctaaaaaattcaattcttaactctatt |
33504696 |
T |
|
| Q |
217 |
ttggttgaccttaccctacaatgcctcatgtgattttagaacgatgctaagttaccaaatttgagttattaacttacctttg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33504695 |
ttggttgaccttaccctacaatgcctcatgtgattttagaacgatgctaagttaccaaatttgagttattaacttacctttg |
33504614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University