View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_79 (Length: 274)
Name: NF9303_low_79
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_79 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 24708588 - 24708338
Alignment:
| Q |
18 |
ttaagagtattgtatatgttcgttacaacttttcagaaaaaatgagaatnnnnnnnntcagataacaacttcgaatgagaagttgatataaatagctttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24708588 |
ttaagagtattgtatatgttcgttacaacttttcagaaaaaatgagaataaaaaaaatcagataacaacttcgaatgagaagttgatataaatagctttt |
24708489 |
T |
 |
| Q |
118 |
gaaaaaatgattttctttagaggagagagaggcaggggaggatttggacatcggagattggtgtggccaaattataagtctacggaaagtatccttttcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24708488 |
gaaaaaatgattttctttagaggagagagaggcaggggaggatttggacatcggagattggtgtggccaaattataagtctacggaaagtatccttttcc |
24708389 |
T |
 |
| Q |
218 |
agtattttaaagtcagtgacgttgttactctcattactgctagtattatct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24708388 |
agtattttaaagtcagtgacgttgttactctcattactgctagttttatct |
24708338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 150068 - 150116
Alignment:
| Q |
18 |
ttaagagtattgtatatgttcgttacaacttttcagaaaaaatgagaat |
66 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| | ||||||| ||||| |
|
|
| T |
150068 |
ttaagagttttgtatatgtttgttacaactttttaaaaaaaatcagaat |
150116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University