View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_88 (Length: 259)
Name: NF9303_low_88
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 34453210 - 34452975
Alignment:
| Q |
1 |
tttatattggcacttcttgtgatttgattgtttgtttctactatattttttgtctttttnnnnnnnnnn---tgtgcaaggatatatcatagctggtata |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34453210 |
tttatattggcacttcttgtgatttgattgtttgtttctactatattttttgtctttttaaaaaaaaaaaaatgtgcaaggatatatcatagctggtata |
34453111 |
T |
 |
| Q |
98 |
gtggtaccttgtaacttaggttaatactatataataagaggtgtttgcaatcacgtttccatgatagtttgacttgcgtttcaaagccgccatgatatca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34453110 |
gtggtaccttgtaacttaggttaatactatataataagaggtgtttggaatcacgtttccatgatagtttgacttgcgttccaaagccgccatgatatca |
34453011 |
T |
 |
| Q |
198 |
aaatatttaatgtgtttagtactatcatcataaata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453010 |
aaatatttaatgtgtttagtactatcatcataaata |
34452975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University