View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_9 (Length: 552)
Name: NF9303_low_9
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_9 |
 | |
|
| [»] scaffold0649 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0649 (Bit Score: 473; Significance: 0; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 473; E-Value: 0
Query Start/End: Original strand, 18 - 542
Target Start/End: Original strand, 4887 - 5411
Alignment:
| Q |
18 |
atgcatgctcagtgatcgcatcgatggtaagtatcaaagctcttgcctccgtttctggaacccggccacgaggtcagcatcgaaaagactcggctattct |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4887 |
atgcatgctcagtgatcgtatcgatggtaagtatcaaagctcttgcctccgtttctggaacccggccacgaggtcagtatcgaaaagactcggctattct |
4986 |
T |
|
| Q |
118 |
tacgttgagcttagggttaaacatctctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggcttatagtcccggtattg |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
4987 |
tacgttgagcttagggttagacatctctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggttgtggcctatagtcccggtattg |
5086 |
T |
|
| Q |
218 |
caaaagtgtttagtttaggtgatcatgtttggaagagtattgaaagtttcccatcgactccttttcgttgcactcgttccgctcagactggtttggatca |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
5087 |
cgaaagtgtttagtttaggtgatcatgtttggaagagtattgaaagtttcccttcgactccttttcgttgcactcgttctgctcggactggtttggatca |
5186 |
T |
|
| Q |
318 |
gaatggtggtgtctattttagcaacagtcttaattggtttaccctttgcaataacattgtttatctttactcggattggaaagatcttaacgatacgatt |
417 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5187 |
gaatggtggtgtctattttagtaacagtcttaattggtttaccctttgcaataacattgtttatctttactcggattggaaagatcttaacgatacgatt |
5286 |
T |
|
| Q |
418 |
gaacaatttggcattatctcgcttgatttggggacggacgaatgcacacagttgctcgtacctctagattttgctgaaataccaccgattatgccaattg |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
5287 |
gaacaatttggcattatctcgcttgatttggggacggaggaatgcacacagttgctcgtacctctagattttgatgaaataccacctattatgccaattg |
5386 |
T |
|
| Q |
518 |
tttgcgtattggcagattgcctttg |
542 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5387 |
tttgcgtattggcagattgcctttg |
5411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 200
Target Start/End: Original strand, 20967359 - 20967415
Alignment:
| Q |
144 |
ctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggc |
200 |
Q |
| |
|
|||||| | |||||| ||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
20967359 |
ctatttcagattttcatttggttgcgataatacaaccggaaaatataaggtggtggc |
20967415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 200
Target Start/End: Original strand, 20980182 - 20980238
Alignment:
| Q |
144 |
ctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggc |
200 |
Q |
| |
|
|||||| | |||||| ||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
20980182 |
ctatttcagattttcatttggctacgataatacaaccggaaaatataaggtggtggc |
20980238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 452
Target Start/End: Complemental strand, 15572138 - 15572097
Alignment:
| Q |
411 |
tacgattgaacaatttggcattatctcgcttgatttggggac |
452 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15572138 |
tacgattgaacaatttgtgataatctcgcttgatttggggac |
15572097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University