View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9303_low_98 (Length: 249)
Name: NF9303_low_98
Description: NF9303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9303_low_98 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 138 - 209
Target Start/End: Complemental strand, 42517282 - 42517211
Alignment:
| Q |
138 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42517282 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatggacttattggaagtaaaaata |
42517211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 209
Target Start/End: Complemental strand, 1238706 - 1238635
Alignment:
| Q |
138 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
1238706 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatagacttattgaaagtaaaaata |
1238635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 42517427 - 42517386
Alignment:
| Q |
18 |
aaaccgacagacgaccataacagtggcagtggacaagcctag |
59 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42517427 |
aaaccgacagacgaccataacagtggcggtggacaagcctag |
42517386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 239
Target Start/End: Complemental strand, 41971212 - 41971102
Alignment:
| Q |
138 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaat---------aattaataatcggattgtta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
41971212 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatagacttattgaaagtaaaaatatttattaaaattaataatcggattgtta |
41971113 |
T |
 |
| Q |
229 |
tgtcgtctctg |
239 |
Q |
| |
|
|||||| |||| |
|
|
| T |
41971112 |
tgtcgtttctg |
41971102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University