View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9304_high_4 (Length: 204)
Name: NF9304_high_4
Description: NF9304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9304_high_4 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0689 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 50 - 186
Target Start/End: Original strand, 13226105 - 13226241
Alignment:
| Q |
50 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccccccattaacacagaatttgtaacttgctatcctcttgcctagt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13226105 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccccccattaacacagaatttgtaacttgctatcctcttgcctagt |
13226204 |
T |
 |
| Q |
150 |
attcagtgaaaaggatgattcattcggatcgacatga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13226205 |
attcagtgaaaaggatgattcattcggatcgacatga |
13226241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 50 - 184
Target Start/End: Original strand, 18960246 - 18960380
Alignment:
| Q |
50 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccccccattaacacagaatttgtaacttgctatcctcttgcctagt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
18960246 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccatccattaacacataatttgtaacttgctatcctcttatctagt |
18960345 |
T |
 |
| Q |
150 |
attcagtgaaaaggatgattcattcggatcgacat |
184 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
18960346 |
attcaatgaaaaggatgattcattcagatcgacat |
18960380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 50 - 184
Target Start/End: Original strand, 18992188 - 18992322
Alignment:
| Q |
50 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccccccattaacacagaatttgtaacttgctatcctcttgcctagt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||| || ||||| |
|
|
| T |
18992188 |
cttaggaacacatatacatataagatttatcactacaacaagcataatggtaatccatctattaacacataatttgtaacttgctatcctcatgtctagt |
18992287 |
T |
 |
| Q |
150 |
attcagtgaaaaggatgattcattcggatcgacat |
184 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| |
|
|
| T |
18992288 |
attcagtgaaaatgatgattcattcagatcgacat |
18992322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 116 - 186
Target Start/End: Original strand, 189604 - 189674
Alignment:
| Q |
116 |
acagaatttgtaacttgctatcctcttgcctagtattcagtgaaaaggatgattcattcggatcgacatga |
186 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
189604 |
acagaatttagaacttgctatcctcttgcctagtattcagtgaaaaggatgattcattcggatcgacatga |
189674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0689 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0689
Description:
Target: scaffold0689; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 148
Target Start/End: Complemental strand, 7754 - 7722
Alignment:
| Q |
116 |
acagaatttgtaacttgctatcctcttgcctag |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7754 |
acagaatttgtaacttgctatcctcttgcctag |
7722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University