View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9304_low_6 (Length: 359)
Name: NF9304_low_6
Description: NF9304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9304_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 4287373 - 4287222
Alignment:
| Q |
7 |
atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattac-a |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4287373 |
atatcttgcgtcataacacagaacctttaaaaaggatcaccttttagcaactgcaagatagattgaaagtgtataaaatgatagattaaactgattacaa |
4287274 |
T |
|
| Q |
106 |
aattgcaattcatattaagggatgattcgaaattagtttctaagacagtaaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4287273 |
aattgcaattcatattaagggatgattcgaaattagtttcgaagacagtaaa |
4287222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 344
Target Start/End: Complemental strand, 4287137 - 4287026
Alignment:
| Q |
229 |
gctctgatatctattagttattgttgatttgaaatatgtcatgcatcttgatgctctaatgatcaaatctatcactctgacctggatgacataaattggt |
328 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4287137 |
gctctgatatctattagttagtgttgatttgaaatatgtcat----cttgatgctctaatgatcaaatctatcactctgaactggatgacataaattggt |
4287042 |
T |
|
| Q |
329 |
ttgaactttgaatatt |
344 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
4287041 |
ttgaacttcgaatatt |
4287026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University