View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9304_low_7 (Length: 327)
Name: NF9304_low_7
Description: NF9304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9304_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 53665148 - 53665371
Alignment:
| Q |
1 |
ctttgatattacaacaactctctgtgtctcccatcacatgaacatgaagaaaatcaaaagttgtgagttgtgtctgaaatggaaattgtatataaaactg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665148 |
ctttgatattgcaacaactctctgtgtctcccatcacatgaacatgaagaaaatcaaaagatgtgagttgtgtctgaaatggaaattgtatataaaactg |
53665247 |
T |
|
| Q |
101 |
aagctgatgactattgcaaaggagtgcaacgcgcatctatatttatttataattgatgtggattatacacacaacttcaacattttgattatatcaccgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53665248 |
aagctgatgactattgcaaaggagtgcaatgcgcatctatatttatttatatttgatgtggattatacgcacaacttcaacattttgattatatcaccgt |
53665347 |
T |
|
| Q |
201 |
ttcttgtccaagaatccaccatcc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53665348 |
ttcttgtccaagaatccaccatcc |
53665371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 237 - 322
Target Start/End: Original strand, 53665400 - 53665485
Alignment:
| Q |
237 |
tactagtaaagtagtaatgtcgatgaatgcaaggaattataatgctttaattatgtaatcctttgatggcatcactaccaccaaac |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665400 |
tactggtaaagtagtaatgtcgatgaatgcaaggaattataatgctttaattatgtaatcctttgatggcatcactaccaccaaac |
53665485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University