View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9304_low_9 (Length: 315)
Name: NF9304_low_9
Description: NF9304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9304_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 42594467 - 42594763
Alignment:
| Q |
1 |
tatgccaatcccaccaagctcaagaagagatttcaagtccttctttttcacaatttcagcaatatccacctcttgagtatgtgagggtatatcaatacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42594467 |
tatgccaatcccaccaagctcaagaagagatttcaagtccttctttttcacaatttcagcaatatccccctcttgagtatgtgagggtatatcaatacca |
42594566 |
T |
 |
| Q |
101 |
acggaagattttgcagaggaggttctagcaggaggagtaggaggcaatgaagtgtatggtactgaagagattggtgatggtggaggagattcttggtagt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42594567 |
acagaagattttgcagaggaggttctagcaggaggagtaggaggcaatgaagtgtatggtactgaagagattggtgatggtggaggagattcttggtagt |
42594666 |
T |
 |
| Q |
201 |
tttcagtagaagttgtaggtttcttcaaggagataaggaaccctatgtataaacttttacgccatttcttgttgtacttgctactgctggtagtagt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42594667 |
tttcagtagaagttgtaggtttcttcaaggagataaggaaccctatgtataaacttttacgccatttcttgttgtacttgctactgctggtagtagt |
42594763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 66
Target Start/End: Complemental strand, 4089871 - 4089810
Alignment:
| Q |
5 |
ccaatcccaccaagctcaagaagagatttcaagtccttctttttcacaatttcagcaatatc |
66 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
4089871 |
ccaaccccaccaaactcaagaagagacttcaagtccttctccttcacaattccagcaatatc |
4089810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University