View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9305_low_14 (Length: 243)
Name: NF9305_low_14
Description: NF9305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9305_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 130 - 223
Target Start/End: Complemental strand, 33276445 - 33276352
Alignment:
| Q |
130 |
agtcgcatgatgtttaattatgggcttgtttgactttggtttccattgctttatgaaagtcagtttgcttctttcccttattgtcttgttttaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33276445 |
agtcgcatgatgtttaattatgggcttgtttgactttggtttccattgctttatgagagtcactttgcttctttcccttattgtcttgttttaa |
33276352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 33276562 - 33276488
Alignment:
| Q |
13 |
agcagagacaaccatcctctggaaaccatgaacaaccttggaattaccagcacatattagtactaagttgtgata |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33276562 |
agcagagacaaccatcctctggaaaccatgaacaaccttggaattaccagcacatattagtactaagttgtgata |
33276488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University