View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9305_low_15 (Length: 239)
Name: NF9305_low_15
Description: NF9305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9305_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6061104 - 6061326
Alignment:
| Q |
1 |
aacttctatttgatgttagttatatttctgtactgttatgcatacgattttgcttgctaaggtttcaatctgcaaggccatttaatgtacaatggtttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6061104 |
aacttctatttgatgttagttatatttctgtactgttatgcatacaattttgcttgctaaggtttcaatctgcaaggccatttaatgtacaatggtttaa |
6061203 |
T |
 |
| Q |
101 |
ttttgacatgatcgaccaatgcgaaattcatttgcaaaattatttgctttaagcaatacaagttgtgaagatatgtatgtgctgcctgatggtcatcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6061204 |
ttttgacatgatcgaccaatgcgaaattcatttgcaaaattatttgctttaagcaatacaagttgtgaagatatgtatgtgctgcctgatggtcatcaat |
6061303 |
T |
 |
| Q |
201 |
aatacattgtaattcgattgaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6061304 |
aatacattgtaattcgattgaag |
6061326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University